Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652704
Length 631 bp
Fasta Format > whgc10e14
gatgtggctgaggctcctgcagctgatgatgacgatgacagcgatgttga cctttttggagaggaaaccgaagaggagaagaaggcagctgaagagcgtg ctgccaaagctaaggcttctaccaagaagaaagaatctggcaagtcatca gttttgcttgatgttaagccatgggacgatgagactgacatggtcaagct ggaggaagctgtccgaagcatcangatggagggccttctgtggggtgctt ccaagctcatgccagttggatatggcatcaagaagctccagattatgatg accatcattgatgacctcgtctctgtcgacactcttattgaagaccatct ctgcnttgaaccagccnacgagtacatccggagctgtgacattgttgcct tcaacaaaatctaaatcttcctgaggcaggtgatggcggtgggtggacaa tgcagcagcacaatatatctacagttttccgttgccgtgatggtgtcgta gctgaagcaagcataacatatctgccctgtgaggtttttggaccttaggt cgagttgagtcgtagtgttattactgagtgttatttgcttcgtatganat gagacaatgtggttggattccnaaaaaaaaa
Download
page-top