Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652697
Length 673 bp
Fasta Format > whgc10e01
cccggcggcggcgcgtggctcggcggccagctcttctccgccatggtcgt gcgcaagccggcgcacctcttcctcgacgagctcaacatcgagtacgacg agcaggaggactacgtcgtcatcaagcacgccgcgctcttcacctccacc gtcatgagccgcctcctcgcgcgccccaacgtcaagctcttcaacgccgt cgccgtggaggacctcatcgtcaaggaggaccgcgtcgccggcgtcgtca ccaactgggcgctcgtctccatgaaccacgacacacagtcctgcatggac cccaacgtcatggaggccaaggtcgtggtgagctcctgcggccacgacgg gcccttcggcgccaccggggtcaagcggctccaggacatcggcatgatcc aggcggtgcccgggatgaaggcgctcgacatgaacacggccgaggatgcc atcgtgcgcctcacccgcgaggttgtccccggcatgattgtcaccggcat ggaggtcgccgagatcgacggcgccccgagaatgggcccgaccttcngcg ccatgatgatctccggccanaangcggcgcanctggcgctcaaggccctc ngccggccgaacggcatcnacnggacnctcaanaacntgaccccngnnct gcacccnganatnatcctggnng
Download
page-top