Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652695
Length 621 bp
Fasta Format > whgc10d23
gcgtaccgccctgccatagtcgcgaggatcttaatagtcggtcgcgactg ttgtcatagtcaacgacggttgaaacttccaggaaaaaacttcgaattgg gagggcgatcctcccggtgaactgaccgtaccccaaaccgacacaggtga acaagtagagtatactagggcgcgtcgagagaaccatgtcgaaggaactc ggcaaaatgaccccgtaacttcgggagaaggggtgctctcctatcttttg attaggaaagcggcacataccagggggtagcgactgtttattaaaaacac aggactctgctaagtggtaacacgatgtatagagtctgacacctgcccgg tgctggaaggtcggaaggagaagtgtgataagctttgaatggaagccccg gtaaacggcggcagtaactctaactgtcctaaggtagcgaaattccttgt cgcataagtagcgacctgcacgaatggtgtaacgactgccccgctgtctc cgacatggacccggtgaaattgaattctccgtgaagatgcggagtaccaa cggctagacggtaagaccccgtgcaccttgactatngcttcgcagtgaca accttgatcgaatgtgtagga
Download
page-top