Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652694
Length 639 bp
Fasta Format > whgc10d22
acgagaaaccaggggaactagccctagccgccgccacgtgatcgaatcct tctcaccttcgtatggaggatttggttgcctgctgcgggcggctgtgttg gcgatccacagcgccgatcttcaacggcagcacggcctggataggtcaac ggagaagagggagtcggtgcatggttctgcgcgacggcgagttcggcatc atacccaaacctattgtgcagcggcatgggtgatttccttttttcagatt ttctttagagaatcatcgagtggagggcttgtggagccgtcgatcggcgt ttatggtcttcggagtttgtataggctcttatcaacgttttcttctccgg ggcagcgatttgcttcgcagatcacggatgttggtgtctcctgatctgca tcgacgagttcccggtcgctccttctacaagctcctgggtctaaaaaagt ttgctctgccaaggcgagggctagaggcggcatcgagttatgctcacaat gcgccgccgatggatacgggaggaagaagacttcggcgcccccaagaatt tgaatgtaattttatttttctgtatgggtgtatttgtaagaccttttgat acttaatatatggccttctgcaatttcacaaaaaaaaaa
Download
page-top