Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652692
Length 714 bp
Fasta Format > whgc10d19
gtggagtccaggtcggactcaccgcgcctccgattcgatccccccacgcc ggggttcagcaggaatcctaagcttggaagggcggaggaatcctgcacac acatagctccggaatcccgcaagcgcgagaacgcccggagctaaacccga gttactgctgcgacatgaagcccaaggttgccgcagccgctgccggcggc gagaagggccggggagtggacccgtcgctgccgcggttcaagtgccagga atgccaccgggcgctcgtcgtcgtcggcgtggagtcattccccgataggt tgcccgctcacgccaactccggtatacatgcatcctctgttcagggcagc attatgggggcgagcaggatggacagttcttacgttgtgttgtccaagca gaacagatctcaaggccccaggattcccccacggccacctagtgcagcag cccggcatgttgagcctaaccaatcaacaagagcaatagaggggtcatat ataatgcttccacctgccgctgcttccatatacaagacatctacctccga aggaggtggcgcgcatctgtcgcctccaaatgttaactctactagccctt caccaggcaacaattctggatttcactctagtgtgactgtcttaaagcgg gcatttgagattgctagttcacaaactcaggttgagcagccactctgtct ggaatgcatgaggg
Download
page-top