Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652675
Length 717 bp
Fasta Format > whgc10c15
acacgcagttccgcacaaactattcactcttcatgccattttacgactac atatacagcactatggacaaggcatctgacgagctgtatgagagctcact gaaagggacagaggagacacctgaccttgttcatctcacacatatgacca acttgcaatcggcttatcatctaagggttggattcgcctccatagcatcc aaaccatctgataactccgagtggtatatgtggacgctatggcccttggc atggctgtcaatggtggtagcatggatttatgggtcatctgcattcgtgg tcgagagaatcaaactgaagaagatgaagatgcaaacatgggtcgtaccg agatacaacttccaatatggtctaacatgggatagagaatcgatcaacga cttaattgaaaaggcgatattggatgctgatgtaagaggggttaaggtgc tcagcctagggctactaaatcaggcaaaacagctcaatgggaatggtgaa ctatttagacaaaaatacccaaaattaggagttcgaattgttgatggaag tggcttagcaactggagttgtcctaaaaagcatcccttcagatgcaaagc aagtttttcttcatacagggacttctaagatagcccgtgccgttgctatg gctttatgtggcaagggcatccaggtgatcatgaatcgtaagaaagagta tgacatgctcaagtcac
Download
page-top