Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652671
Length 267 bp
Fasta Format > whgc10c11
gagagagatatacttagttcgtctgagttgtttaccgtttttagcacctt tatcccaagacagttcctcctgggaggaggtggcagcgacagttgttttt aagttatgttaattaatccgtagactgatgatatccgtgaggaggatgag aaggttcgggccaaatggcccgaccttgtggactgattagaaatcctgcc tgtcgtgttggtctgagacagttttggtttttaaatcaaaagtgctgttg aaacttgaaaaaaaaaa
Download
page-top