Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652670
Length 263 bp
Fasta Format > whgc10c06
aaaggaggaggaatcttctgactcgcagaagtaggcacttgcaaagtatc cccgttgtaatatctagaccaatctctgccagtaaattaatgtgatattt cccctggtttgatcattgttcttgtatttgtgacttcctcttatgtaagt agaggttgtgtagctatcaattatttatctgttttgggtgcttttgtcga ggtacacgagctattgatgaactggaatcgtatgcagtttatggtagttc tgtaaaaaaaaaa
Download
page-top