Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652669
Length 558 bp
Fasta Format > whgc10c04
caccctataaacaggcggattgctacaaatcatgcgggcacaaatgcttg gaccaccaccaccaccaccaccatcaccatcaccaccaccacccaagccc gggtccaaagcccccgagtccgaagccaccaaagccggagccaaagccga cgccaccaaagcccacacctccnaagcccgctccaccgaagcccatgccg ccaccgtcgcccatatcgccgccgtcgcccatgccgccgaaaccaacccc gccgaagccgctgctaaagcggccgtgccatcctaatgcacggaagccaa ggctaccgtgtccgtcgaagactaactcgaaaccgaaggcaaagtcgaag ccgaagccaccgtgcccgtcgtcggccactgtatctgtgtcgaccaacac tagcaacaactgatggttatacaccatgacgtctatgcgcacatatttga aacagagcttgtcatatatatagcacaaagccattatgagtatatataga ttattgtataaggttactctatagatgaagaactaattcatcagctctaa aaaaaaaa
Download
page-top