Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652661
Length 274 bp
Fasta Format > whgc10b13
atgcatccttgctaataactagtaggtcctatttatccagacctgattct tgttgctgacaccaacccaacccccaccccatcccattcatgtgtatatt ttcatggagccgagcattggtggtcagcagcaggaggatctgcttgctta attttaattttagttttaattactgccgcatcgattgtagcgcgttgttt gtttgtttgtttgtttgtttgtttgtttggatggtgaatgaatgaatgaa tgaatttcctccttaaaaaaaaaa
Download
page-top