Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652659
Length 662 bp
Fasta Format > whgc10b09
tcatcgcccatcaacgcgcagctcgcgtaacatttgcaggccctcgtcgc cccttggaggtttcggtttgccatggcggaccagctcagcgaggagcaga ttggcgagttcaaggaggccttcagcctcttcgacaaggacggcgatggt agcatcaccaccaaggagcttggaaccgtgatgcgctccctcggccagaa ccctaccgaggcggagctgcaggacatgatcaacgaggtggatgcggacg gcaatggcaccatcgacttcccagagttcctgaacctgatggcccgcaag atgaaggacaccgactctgaggaggagctcaaggaggcgttccgcgtgtt tgacaaggaccagaacggtttcatctctgcagtggagctccgccaggtga tgaccaacctcggggagaagctgtcggaggaggaggtggaggagatggtc cgcgaggccgatgtggacggcgatggccagatcaactacgacgagttcgt caaggtcatgatggccaagtgaggaaccaccccctctgaaataacccttt ctatttccgccgaataacgaaccgtctggcaccactacttcataacaatt tttaccttattattacntgcacgctgctggtactgacacttgttggctag gtgtagtcactg
Download
page-top