Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652658
Length 482 bp
Fasta Format > whgc10b08
gcccaccaccatccgcacgacattttcgccacccaacccggcaaatcgcc aatcaccatcgtcttctttgtctcctccagcgagccacacgaatcctctc cgaccaagaagagaagagaagagaagggaagagaagagagatgggagggt tccagcggcaggtgaaggagcggaccatggaggtgaaggtggcggtgctc aagggcgtcagggtcgtcggcgacttcggcaagaagacgtggaacaaggt caaggccatcaagcgctgatcgatccatccatcgcatcaccccggccgtc tgcttcccttccctccagtccaatagttgcttcatgtagtactgcctgat aggatagccgtctggcctcgctctctttttctcggttgtggttgtgattt ggtttgttggatctgttttgaggcaacttttgatgcatgtgaaaattcgc ctgtcagcataggcttatatttaaaaaaaaaa
Download
page-top