Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652651
Length 696 bp
Fasta Format > whgc10a23
ggccgattcgaggcggactgggggttcgggttcggggcggggaagagggg aggagggggagatggaccaggtgctgaacaaggtggggagctactggttc agcaagagggccagcaaggagatcgactccatcggcgacgacctcaactc ggtctcttccagtattggcgggggagctaaatggatggtgaacaagatca aaggcaagctgcagaaagcattaccagatcttctcaaagaatatgacatg ccagcaggcctcttcccacgggacacaactaattacgagttcaatgaaga gacaaagaagctgacagtgtacatcccgtcagcttgtgacgtcgggtaca aggactcatcggtggtgcggttcttcacctgtgtgaccggctacctcgag aagggaaagctttctgacatcgagggcatgaagaccaaggtgcttgtatg gaccaaggtgacctccatcaagaccgagggctcaaaggtccatttcactg ccggcatgaagaagacccgcagccgcgatgcgtatgaggttgtcagagat ggcatcatcatagacaagttctagagcatacctgtacctgggctggcagg tgcaatgtaattacttagatatgctacattggaatctgttgtgctatcgg atcggcctattaaccaactgtgttgctcaaatctccnaaaaaaaaa
Download
page-top