Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652647
Length 668 bp
Fasta Format > whgc10a19
aagccatgattctgtcgcaccaagcagtgtgcctgaaacatctacttctt ctggtgccatatgcctagcttccccaagtgtgaaacccaaaagtagggat tctcctatacgaataatgtcacctgaaagctctgcaaatcatggtgccaa aaatcaggatccttctgcagctagaatggcacctacacttcataacgtcc ttctgaggacagcttctggaaaatctgcatctcatggttatgcttctcca gcaccaagtaatgcctcaaaaggccgtgggattagtgctccaggactcag tctgaagggctctgaatgtcctgggccagttttggcactgggaagcacca aattcagagggatgaaaagtcccagctctgtgccaagaatgacacctgaa ggcccggaatttctttcactgagtattgcgccacaaagccaagcaattta tccaactaagtgccatggtggtgattcaatttcttctgtcgcagctccag ctcatgtgccaggacatgtgaactcttcagctttgagcgctgaaggctgc gattctctagcactgagtatcgcgccaaactgccatgatcctccagcatc aagcaacaacgagccagcgctccatggggctccaacaacacatacngcat ctgaaggcgagcactctc
Download
page-top