Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652642
Length 443 bp
Fasta Format > whgc10a14
aggatgtgcccaggcaaggaaatcgcagttgtgcagatgaagaccatcat cgccgcaatcgtgtggaactttgacctggagctggnggaaggccagagca tccnacccaagctatcttgtttactgcagatgaaaaatgggctcatgatg aagctgaagaaacgagaagcgtancacaaactttcttttgntgaccgggg ttngggatttcccagcatgtgtgccacgattgtcttagaatgcgtgtgta gtgtatgtgtgtgtccatatacatattttcgctttcaagtcggacaactt tattcacggcaatgggtggattttttttatgaataattgcctgagaaatc agctatggcttggatggcgcanatgttctcanaaatcatgtataaaaaat accggaacatcgtgataataatgnaagattatcgaaacganaa
Download
page-top