Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652637
Length 658 bp
Fasta Format > whgc10a07
tgcagtacaatccactggaatcttgcgttatgagcgcgtgtttggggagg gttatgttagcaccggtggattcgagaccacaaaggagtttgtggacaag ctggacctgaaagctggccagaaggtgctcgatgtagggtgtggtatcgg aggaggcgacttctacatggctgaaacctatgatgtccatgtcctcggca tcgatctttctatcaacatggtttcgttcgcaattgagcgtgccatcggg cgctcgtgctccgttgagtttgaggttgctgactgcaccaccaaggaata cgcagagaacacgtttgatgtcatctacagccgtgacaccatcctccaca ttcaagacaaacctgctctgttcagaaacttcttcaagtggctcaagcct gggggcaaagtgctgatcagtgactactgcaggagccctgggacaccatc agaggaattcgctgcgtacatcaagcagagaggctatgacctccatgatg tgaagacctacggaaagatgcttgaggatgccggtttccatgatgtcgtc gctgaggaccgcaccgaccagttcctgagggtcctggagagggagctggg cgagaccgagaagaacaaggaggccttcctggcggacttcacccaggagg actacgac
Download
page-top