Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652636
Length 696 bp
Fasta Format > whgc10a05
ccgacaggccgtccccgctgcgctccccctgagctcctctgccgccccaa ggagcattttctacccgagcacggagaaccacaagtttccatttaaattt ggtcgccatggcgtgggagcttatcgaggtcgccggctacctaactcccc tcccacattctacagttgatgtggtggctgcgaaggttgaatccaaggta gccaatgctgtcattaggcaacttaatcaggtgtgcccactggagaatct gcggcatgttaatcgggtgcgtcgccttattgagtgtgaaaaatccgagt tatcgatcatcttatgcctttccactgggattgaaagttctaagaatggg ttttctgaggatgtgcagaaggtagtggaggcttaccagttgagcccttt cattgcaaaagttgccagctatcctgctatgtcgaaagaggaatgggagg aacagtgcaaactctggccaacttcatatcatcccctgcatgacactggt ggtgcatctggatttaaagaggaggaattaccatcaatatttgattgcat gaggactgctatcgaattatcagaggtgggcaacacggccattattgttg atccatcaagtatgcaaataatttcaaaggctacagatgaaacacaccan catgacggctttctggaaaggaacagatgtgtcaatgtggaagcag
Download
page-top