Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ541989
Length 510 bp
Fasta Format > rwhem19l11
atgngcacaacaggtgtatgcgattttaatggtatgtcggagccggtaac cttcttctccgtcgacctgctcagcaccttcctcacctcatccgcaagca caatgatcgagtcgtcttcatggcttatattggacagtgccttctccatt gagagcaggtagtccctattatatccattagggccactggctgtagcaat ttgccttgccatatcctccaaagcagcagggccaagatagtatttgttgc caactggatcaggagtggatacgaaaactaatacatccgtcacagctggt tccagagaatttccatccttgtagaaatccacagagatcttctggtcata ctcgcattctcttctctccaagtactgcattgcttctcgctctttttcta gaccacctttgacacaataagcaattcccccagcatatggcttcatcttc ggattcaagggtgcaggtcctggccggatgctgngggtgtgcctctatgg tcaatgcaag
Download
page-top