Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ541700
Length 740 bp
Fasta Format > rwhem18l04
ataacgaactggttccacgagtaccacaaacagctaaccgcgcttaatgt ttggccagccaaaagacaaaaccgatacagctaaaacgtgccaaaaccat ccaacgtcgacactaagataaaaacaactaggcggtgcagggcatggaca tctgacgacgacagccgacaggcagccttggcgcttagtcgacctcctcc atcttgctctcgccggcgtcgtcctccaggggcggcatgtcggtgtcgtt ctctggcgcctcgtcatcctcatcaatgctcaggccaagcttgagcatgc ggtggatcctggtgccgaaggtgttggggtcctccaggctgaagccggag gtgagcagggaggtctcgaagagcagcatcacgaggtccttgacagactt gtcgttcttgtcggcatcggcacgcttacggagctcgtccatgatggcgt tctcagggttgatctccatggtcttcttgctcgacatgtagccagccatg ctcgagtcccttaaggcctgggccttcatgatcctctccatgttggcggt ccacccatattcgccagtcaccagacagcaaggggagtccaccacacggt cagagacgataaccttctcaaccttgtcgcccagcacctccttgatgacc ttgcacagcccctcaaacttctccttgagctcctcctgcttcttcttctc gtcctcgctctcatcaagcttcanaaccntccttggtggc
Download
page-top