Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ541679
Length 612 bp
Fasta Format > rwhem18k01
aaattgaacatacacctcgagtaggatgaccacggatgtatgtattacac tctttcatccacaacaggcaagcacggacgccgccttggcctgcttgtgt tgctggcgatggcgagaggcccgtcgagagaagactcacttcttctccgc tgctttatggtctggattcttcagtatgccaccgtcgatgagcagctgca cctcggatttcgcaagatccttcaccttggaatccggagattccagatag gcagccaccaccttggagctgaatccatctgcaaatgacttgcacttccc tttgagggcttttttccatagggtagcggcaaactcagggcaatcaagta tcatctttctgattacgcggctcgagtggtagttatcaaaggcgtgctca acatcttctgtcctcgggcgtgctgcgtcagaagctatagcattgtgaag cacgtggaccctgtcggtgaccccctccaagacattattttttccaccta cagcaacctcgtataatacatctttgccgaagtttgttctaagtaactct ccaacattttcaatgcaagtctcgatgagaacctcaaaaagctcgctttt caccaacagttc
Download
page-top