Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ541037
Length 695 bp
Fasta Format > rwhem16d24
ataacacttgaagtcttaggctttcgcattagcactctggaagctacagc ctttgccacaatagttgccaaagaaaattagcgcacaccctcaatggtgc cagagctgaagtaaaccacagatctttcaatggtagaatgtcaagagtga gtgtggtcagaggaaaatgccatctctttcgctgatccagccgtgctgct cttcttactatgttgaaaccgcaacggtgccctcaggaagagcagagatg tgcacaacaggtgtatgcgattttaatggtatgtcggagccggtaacctt cttctccgtcgacctgctcagcaccttcctcacctcatccgcaagcacaa tgatcgagtcgtcttcatggcttatattggacagtgccttctccattgag aacaggtagtccctattatatccattagggccactggctgtagcaatttg ccttgccatatcctccaaagcagcagggccaagatagtatttgttgccaa ctggatcaggagtggatacgaaaactaatacatccgtcacagctggttcc agagaatttccatccttgtagaaatccacagagatcttctggtcatactc gcattctcttctctccaagtactgcattgcttctcgctctttttctagac cacctttgacacaataagcaattccccagcatatggcttcatctt
Download
page-top