Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ540921
Length 609 bp
Fasta Format > rwhem15n05
ggagccactaaggccctttgctaagtaacaactacaaaattccaataaca taagaaaccacgacacaagcgcctactgcaggaccctccctctggcttat atgatgccgatcttgttggccacgtcaagagcatcgtagtctggtgtcag cttcacgtacgccttcttcttgccatcaggcctgatgagggtgttaacat tcttggcctgaatgtcatacattttcttgacagcagcctttattttcttc ttgtcggccttgaggtcgacaatgaagacaagggtgttgttgtcttcaat cttcttcatcgcagactcagtggtaagcgggtacttgaggatctggtact ggtctaatttgttccttccaggggtgctgatcctggggtacttggggtcc ctggccttggacagggtcttggggcggtgaaatgtcacagaagtgcggat cttctttgccgtcttcttgattgacccagacttcacagccttggcaacct tggcggcctgggccttggcatcgcccttcttggcaacagcaactttggga gccatttgagcttctcagaaaagcctcttgaacttaccttcctggggtgc gggcgcgag
Download
page-top