Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ540740
Length 767 bp
Fasta Format > rwhem15c02
tttgcctacaacacatatacatggtacaaacatgatgtgacgacacgggt tacagatgatctaccagttctcaaatcagcagagatagccaacacagcat tgaagcaacacaaggtcacatccaaaaggccaaaccgttgtactacaaca ttggaagtgcagagaccaactacaacaaagtaacatttgtgggcgggcta tcaagcaccgcggtaccctatcccttctgagttgagaggttttgcactgt cacatagcatacactatctccccgctgctttcgacgtcgaggtcggcgtc tgaatcaaggtcgtccatgtcgtcgtcaaggtccagaccgtcgttcaaga actggttgatccgggaaccagcggccgggatggtggcctccgccaggatc tgcatgatctcgtccatgctctgcatcggctgttcaggctcctcatactg gctgctcatggtgctgtcgtccactaggtcagctgggaggttcttcaaga accacggatggtttcttatctccgggattgtgattctggtagctgggttg ccaacgaaaatcttggcgataagatctcgacactcggaagatatgtgcac gtaatcgggaatcgagtactgcacactcaatatcctctgaattgtcttcc taaaatttttgggctcatcangatcctcaaagggatatgcaccaactanc ataacataaaagtgtcactccacaggaccacacatccncaatctttccat catattccttcttcnna
Download
page-top