Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ539938
Length 428 bp
Fasta Format > rwhem12b17
gttagccggtgacaatggacggaaagagtaaccatctaggtacaagcagg ggcaccccgcggaagaggacatacaccctccaccactagggcatccccgc cggcggcggcgccaacagggagcgctatccgttatagcaggacaatgaca ggaaaaaggtaaaacaacatcacgatgtgaagtgaaacttgggataattc tagtggagatggataggctccttatgacaccaccgcacacagctcaggtc cgttctcgcacagcagctcccgacttgtccgccggagcagccttgacaag atgcgtcttcttcactcgtcatcgtcctcgtcctcatcgctgccctcatc gtcatcgtcgtcattgatctccgacttggacttgtcagattcctcctcat cttcctcctctacctccttggccgcagc
Download
page-top