Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ539765
Length 627 bp
Fasta Format > rwhem11g11
atcgatagacatcaaaacaaagtgataggacatcccaatagcaatacagc cacgactcaacagacagaaaataatagtgcagctctcttagcagcaaaag caaactagacccatatgataacagaactaaaagtttagagcttgtcctcg aaatcagatagaggggtcatctgttccttcagacccttgcgcttgcggat ctccgtgacaagggtcgcagactgggagccggcctccaaaggatccgaag acatgatgtcccagtggtcgaacacacactgggggaaagcctggccagat gtcgcagccctgagggtacttgagaacccgaacgactcgatgaccgggag gtaagccttgatgttgtacagcggggtaccaggcctctgcatctcctcaa acacgtgccctctcttctgattcagaacaccatagataccgccgagtgca ttctccggggcctggatctcaaccaggtacacaggctccagtagccttgg cttagcagtgagctgagaagcataaatgaccctccgggctgttgggatga cctgaccaccacccctgtgaatagcatcagtgtgcagaacaacatcacag acctcaaagcagatgccacgcatgttc
Download
page-top