Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ539675
Length 697 bp
Fasta Format > rwhem11b01
agccatctaaagatggtgctccttacaaagtttcaacacaacggtaacaa gcatacacgcagagaggtgggctatgctagattttctgtatactcagagc gcgcaagctggtaacgcctgctagcgctagcacacaactaaatatactgc accaccaatatatagctgctttgcatgtagactctgatatggagctggca gttgctcagaaaccatgaatcttgatgtgttccttcttcacaatgccggc ctggacaaggaagtttgagacgttcttcctctgatcaccctggagttgaa tgacctgtccaagttctgtgtcctggacaactgtaccattgcagcaaaac tctttcttgaggtctttgaggatcttgctgtagctgaactccttcttcag accctggacagtggtcaggctcttgcgaccattacgctgctggatgcgta catgaacgtagtcttttgatccggcagctgcaccagcgtccccagcattc gcctcggcaaaggggtcaaaggcagttgggatctgaacgtcaagatcaga catgaaatctcctgctgagactggcaaaagctgcaccaagaacctgggag gcggtcgaggaggaagagatcaaccaagatctttcccgggaggatttgga tcgcggagaggcgctggtantgagtccttggtgttcttcctcctctt
Download
page-top