Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ289068
Length 455 bp
Fasta Format > whsl3a07
gcnagacccctcccctcccctcccctcccccaacccaccggcggcggcgc agcgcagcttgaggaaggaagcgaagatggtgaagttcctgaagcccggc aaggcggtgatcctgctgcagggcaggtacgcggggaagaaggcggtgat cgtgcgcgtgttcgaggagggcacccgcgaccgcccgtacgggcactgcc tcgtcgccgggctggccaagtacccgaagaaggtgatccgcaaggactcg gccaagaagacggccaagaagtcccgcgtcaaggtgttcctcaagctcgt caacttcacccatctcatgcccacccgctataccctcgacgtcgacctca aggaggtggcctccggcgcgcccgactccctcacctccaaggacaagaag gtgggcgccgccaaggccgccaaggccaagctcgaggagaggttcaagac cgnna
Download
page-top