Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ543953
Length 569 bp
Fasta Format > rwhem6o19
agcaataacactcaggtagtaatactacgaatcaactcgatctaaggtcc aaaaacctcacagggcagatatgttatgcttgctttagctacgacaccat cacggcaacagaaaactgtagatatattgtgcgcccaccgccatcacctg cctcaggaagatttagattttgttgaaggcaacaatgtcacagctctgga tgtactcgttggctggttcaacgcagagatggtcttcaataagagtgtcg acagagacgaggtcatcaatgatggtcatcataatctggagcttcttgat gccatatccaacgggcatgagcttggaagcaccccacagaaggccctcca tcttgatgcttcggacagcttcctccagcttgaccatgtcggtctcatcg tcccatggcttaacatcaagcaaaactgatgacttgccagattctttctt cttggtagaagcctttgctttggcagcgcgctcttcagctgcctttttct cctcctcggtttcctctccaaaaaggtcaacatcgctgtcatcgtcatca tcagctgcaggagcctcag
Download
page-top