Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ543861
Length 802 bp
Fasta Format > rwhem6j10
gattctggcattcacatatagcggcaagaaaatactacagacaaatgata ctaggtccactaggataatgggaaacacggggatacagtcgtctagacac gcggcagttgcatcagaccattttgtggctcaaaaagtttctaatcgtca ccaaatgtggtcttcttccctgcgctagctgtgccagcactctgtctgct ctgaaagcctcggccgcctcctctgccgccatcacggccaccagaccggc caaacctgccgccaccatcacggccaccagaccggccaaacctgccgccg ccatcacggccaccagaccggccaaacctgccaccaccagagcggccacc atctctgccaccagatcgaccaccaacgccaccaaattgacccttaggct tagcttcggcaacatacaagttgcagccacctaggtcagatccactaagc tcaagtgctttcgaaaaggaactctcatcagtaaaatccatgtaagctat ccctttgcttgcaccattctcataatccatcggaactgagacacgtgtga tttctccacatttagagaagtgttcttgaagagagctccgaatagcatcc tcctgttgagatgaatcaaaacccttgacaaatactgagaggctgggacc tccacttggttttccaaacgatccaccatccctggtgcgaggagttgcac ctctttcagcagccatgtcaagtctcaccggacggcccattaaatctcca ccattcagtgaatcaagcgctttctgagcatcttcagccgtagcaaactc aa
Download
page-top