Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ543675
Length 159 bp
Fasta Format > rwhem5p07
taaccgcgcttaatgtttggccagccaaaagacaaaaccgatacagctaa aacgtgccaaaaccatccaacgtcgacactaagataaaaacaactaggcg gtgcagggcatggacatctgacgacgacagccgacaggcagccttggcgc ttagtcgac
Download
page-top