Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ543584
Length 710 bp
Fasta Format > rwhem5k08
cacagatatgcctcgacataaaggttctagcacaagcttcaagtagtctc agaacgaaggtagcaaaacctgatggctcaaacaaaatactatcaaggtg tgcatagggcagcttaacggtagcggcggagggagacggtctggttgcgc ttccaggtggctctccttgagggcctgttcttgtggtggcggtggccctt gccacgcagaccacggaatttctttcccgccgacgtgagtccgcgaagct cacggtgcttgtgcacgggcttgcagagccagttgatccttgggtcgttg cggacagcactgtgagcaacatcaacaaggatgacctcaaagtacttgta ggtagagtcctcattcacccagtaggagttgagcacacgaagaccaccca gcctgcgcccagctctttcttcagcaacagacctcttgttcctctggaac ttgagctgggtaataccctggtgcttgggcttaccatagacaataccctt gggcactggcctcttcctgccaccacgcctgacacggatacggtagacca catacccctgcttggccttgaagccgagacggcgagccctgtcggggcgg gtgggcctggtgatgcgcacgatggccggctgctgcctgtactcccagca acgcacgcgctgcacgaacctcatcacgtccgactgcttcctcctccata gctccgacac
Download
page-top