Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ543572
Length 702 bp
Fasta Format > rwhem5j17
gttcagggaatacaggtacgtacgtacgtacacattatcttatagatcct ggtgcccagccagtgaatgcagccactgcaacaaacaaacaatcacaccc aacacacggccacaacattgtcgagcaccgatcctctttatttatttctt aacagaagctgctctgctcccgaatcatcgcgtccatggcgtcgctgctc agcggccagatcacttggtcgcgatgaacagcccccacttctgctcgccg gcggagctccgcttcagcttcgcgctccagccgttgacgatgtcgtcgta gtcctcctgggtgaagtccgccaggaaggcctccttgttcttctctgtct cgcccagctccctctccaggaccctcaggaactggtcggtgcggtcttcg gcgacaacatcgtggaaaccggcatcctcaagcatcttcccataggtctt cacatcatggaggtcatagcctctctgcttgatgtacgcagcgaattcct ctgatggtgtgccagggctcctgcagtagtcactgatcagcactttgccc ccaggcttgagccacttgaagaagtttctgaacagagcagatttgtcttg gatgtggaggatggtgtcacggctgtagatgacatcaaacgtgttctctg catattccttggtggtgcagtcagcaacctcaaactcaaccgagcacgag cg
Download
page-top