Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ543486
Length 303 bp
Fasta Format > rwhem5e12
attctggcattacaacatatagcggcaagaaaatactacagacaaatgat actaggtccactaggataatgggaaacacggggatacagtcgtctagaca cgcggcagttgcatcagaccattttgtggctcaaaaagtttctaatcgtc accaaatgtggtcttcttccctgcgctagctgtgccagcactctgtctgc tctgaaagcctcggccgcctcctctgccgccatcacggccaccagaccgg ccaaacctgccgccaccatcacggccaccagaccggccaaacctgccgcc gcc
Download
page-top