Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ543468
Length 719 bp
Fasta Format > rwhem5d14
ttagccggtggacaatggacggaaagagtaaccatctaggtacaagcagg ggcaccccgcggaagaggacatacaccctccaccactagggcatccccgc cggcggcggcgccaacagggagcgctatccgttatagcaggacaatgaca ggaaaaaggtaaaacaacatcacgatgtgaagtgaaacttgggataattc tagtggagatggataggctccttatgacaccaccgcacacagctcaggtc cgttctcgcacagcagctcccgacttgtccgccggagcagccttgacaag atgcgtcttcttcactcgtcatcgtcctcgtcctcatcgctgccctcatc gtcatcgtcgtcattgatctccgacttggacttgtcagattcctcctcat cttcctcctctacctccttggccgcagccttctttggggcagcagcagca gcgctctcgcccttgttgtaggcagcaatggccttgttgtactcgccctt gagcttgttggccttggccacatagggggccttttccgattcgctcaagc tcttccacctctcaccggccgctttgccgacggcggcgacggacttgttc ttggggttcttctgcttgaactcctcgcggaactcgcccatgaagacgaa gaaggcggatggcgccctcttgggcttgttggggtccttgccggccttgc ccttcttccccttggcggc
Download
page-top