Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ543467
Length 768 bp
Fasta Format > rwhem5d13
atcaccagaacatcaaaacatagttcccagtatcacgacaagtaggtcat aacagcaagactcatcgatacaaaatagtgcagctctctttaacaacaca agaccaggtaagggataacagcaccaaaaatttagagcttgtcctcgaaa tcggatagaggggtcatctgctccttgaggcccttcctcttgcggatatc cgtgacgagcgtcgccgactgggtgcctgggtccaaaggatcagaagcca tgatgtcccagtggtcaaacacacactgggggaaggcctggccggacgtc gcggccctcagggtgcttgagaacccaaaggattcaatgacggggaggta ggccttgatgttgtagagcggggtaccttgcctctgcatctcctcgaaca cgtgccctctcttctgattcagaacaccatagataccaccaagcgcattc tccggggcctggatctcaaccaggtacacaggctccagcagccttggctt ggcagtcagctgagaagcataaatgaccctcctggccgtgggaatgacct gaccaccacccctgtggatagcatcagtgtggagaacaacatcacagacc tcaaagcaaatgccacgcatgttctcctcagccaacgcgccttcctttga cgcccactggaaaccagccacaacagagtccttgatttcattaagatact gcactcccttacacatgtcgacgaccatgttggggccagtcgtctcaggt ccaaagcaccaaatctnc
Download
page-top