Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ543429
Length 766 bp
Fasta Format > rwhem5b11
cacatacgaactgttcacgagtaccacaaacagctaaccgcgcttaatgt ttggccagccaaaagacaaaaccgatacagctaaaacgtgccaaaaccat ccaacgtcgacactaagataaaaacaactaggcggtgcagggcatggaca tctgacgacgacagccgacaggcagccttggcgcttagtcgacctcctcc atcttgctctcgccggcgtcgtcctccaggggcggcatgtcggtgtcgtt ctctggcgcctcgtcatcctcatcaatgctcaggccaagcttgagcatgc ggtggatcctggtgccgaaggtgttggggtcctccaggctgaagccggag gtgagcagggaggtctcgaagagcagcatcacgaggtccttgacagactt gtcgttcttgtcggcatcggcacgcttacggagctcgtccatgatggcgt tatcagggttgatctccatggtcttcttgctcgacatgtagccagccatg ctcgagtcccttaaggcctgggccttcatgatcctctccatgttggcggt ccacccatattcgccagtcaccanacagcaaggggagtccaccacacggt canagacgataaccttctcaaccttgtcgcccancacctccttgatgacc ttgcacagcccctcaaacttctccttgagctcctcctgcttcttcttctc gtcctcgctctcatcaagcttcanaccctccttggtggcaaanacaanct tcttgccctcaaactc
Download
page-top