Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ543202
Length 662 bp
Fasta Format > rwhem4d15
gtcacttcgattgcatcaaattcatgaaagtgtgcagcgatatggtaggc aatggagccactaaggccctttgctaagtaacaactacaaaattccaata acataagaaaccacgacacaagcgcctactgcaggaccctccctctggct tatatgatgccgatcttgttggccacgtcaagagcatcgtagtctggtgt cagcttcacgtacgccttcttcttgccatcaggcctgatgagggtgttaa ccttcttggcctgaatgtcatacattttcttgacagcagcctttattttc ttcttgtcggccttgaggtcgacaatgaagacaagggtgttgttgtcttc aatcttcttcatcgcagactcagtggtaagcgggtacttgaggatctggt actggtctaatttgttccttccaggggtgctgatcctggggtacttgggg tccctggccttggacagggtcttggggcggtgaaatgtcacagaagtgcg gatcttctttgccgtcttcttgattgacccanacttcacagccttggcaa cattggcggcctgggccttggcatcncccttcttggcaacagcaactttg ggagccatttgagcttctcanaaaagcctcttgaacttaccttcctgggg tgcgggcgcnan
Download
page-top