Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ543007
Length 679 bp
Fasta Format > rwhem3h05
gatatctaaggtaaacatccgttacatcaccagacatcaaaacatagttc ccagtatcacgacaagtaggtcataacagcaagactcatcgatacaaaat agtgcagctctctttaacaacacaagaccaggtaagggataacagcacca aaaatttagagcttgtcctcgaaatcggatagaggggtcatctgctcctt gaggcccttcctcttgcggatatccgtgacgagcgtcgccgactgggtgc ctgggtccaaaggatcagaagccatgatgtcccagtggtcaaacacacac tgggggaaggcctggccggacgtcgcggccctcagggtgcttgagaaccc aaaggattcaatgacggggaggtaggccttgatgttgtagagcggggtac cttgcctctgcatctcctcgaacacgtgccctctcttctgattcagaaca ccatagataccaccaagcgcattctccggggcctggatctcaaccaggta cacaggctccagcagccttggcttggcagtcagctgagaagcataaatga ccctcctggccgtgggaatgacctgaccaccacccctgtggatagcatca gtgtggagaacaacatcacagacctcaaagcaaatgccacgcatgttctc ctcagccaacgcgccttcctttgacgccc
Download
page-top