Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ542989
Length 742 bp
Fasta Format > rwhem3f22
cattctttcttctggtaacacaggcagatagcaaatagttcaacagatat gcctcgacataaaggttctagcacaagcttcaagtagtctcagaacgaag gtagcaaaacctgatggctcaaacaaaatactatcaaggtgtgcataggg cagcttaacggtagcggcggagggagacggtctggttgcgcttccaggtg gctctccttgagggcctgttcttgtggtggcggtggcccttgccacgcag accacggaatttctttcccgccgacgtgagtccgcgaagctcacggtgct tgtgcacgggcttgcagagccagttgatccttgggtcgttgcggacagca ctgtgagcaacatcaacaaggatgacctcaaagtacttgtaggtagagtc ctcattcacccagtaggagttgagcacacgaagaccacccagcctgcgcc cagctctttcttcagcaacagacctcttgttcctctggaacttgagctgg gtaataccctggtgcttgggcttaccatagacaatacccttgggcactgg cctcttcctgccaccacgcctgacacggatacggtagaccacatacccct gcttggccttgaagccgagacggcgagccctgtcggggcggggtgggcct ggtgatgcncacgatggccggctgctgcctgtactcccancaacgcacgc gctgcacnaacctcatcacgtccgactgcttcctcctccata
Download
page-top