Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ542197
Length 679 bp
Fasta Format > rwhem1h18
tttccgagtccgatttcacagcggacgtcttagaaccataatgcaacgac gggtcgagaacagttcccagatttcatgacaggacggtgacgctggtaca aaatgcaaatccccactaaaacttattcagctcttggacacttccgaatg actgactgactgactggtataagacgacggtgctagacagactccgcctt ggtgtagatccgtacggcgacggccaagcccagtatcgcgagggggacca agaactggaggatcttgatgacgaactcgggggtcttgtcctggttgtag tgcggctgcttgggcggcgtgtacttgaccttggtgggtatcgtggtcgc gtcgatctcaccaacatagtactcatccatcatcgcccgggcggtcgtgc tgtgccccacgtcctcaaagtcgtcggtcgcgtccttggcggttgaagac agcaagacatcgtcgcctccagggtggtcatcaagaaacttggtcacatt gtacaccttgccgccgatgactanccagcagtcgtccttggaggtgtgct tggcgacctcctcgagggtgaacaccttgccaccggacgacnacatggtc tcctcctcctcctctctgctcctctctgctgtcaagcganagtgatggga agggtttggatccaangagggggtgcgga
Download
page-top