Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ542095
Length 528 bp
Fasta Format > rwhem1b17
tttgcagtactcattgcncagatacttaggtctcatacatattaaatccg caaaattcgacctaaaagcacataagataagtaatccttancataaaaga ttccacaggagaactggaattgaactgcttagtcgaacaagctgaagccc atgtcatcatcgctctcttccttagcctcctcctttttctcttctttctt ctcttcagcggcagcancaccaccagcagccggggcagcagcagcagcag ctggagcaccacctccaccagatccgacggaaaggatgaggtcatcgacg ctcctcttctccaggagcttggcgaagagcgcgggccagtaggcctcaac cttgattccggcagccttcaccaccgtcgcgatcttctcagaagtgatgg ggatcccgtcatcgtggaggatgagggcggcaagggtgcaggcgacctcg ctggaagacatggcgacggattctcaccggagcagatctgcgatcttggg aggcgatggaagtggaggcgcaggaggc
Download
page-top