Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ651775
Length 590 bp
Fasta Format > whem6f11
tcgcctcccaagatcgcagatctgctccggtgagaatccgtcgccatgtc ttccagcgaggtcgcctgcacccttgccgccctcatcctccacgatgacg ggatccccatcacttctgagaagatcgcgacggtggtgaaggctgccgga atcaaggttgaggcctactggcccgcgctcttcgccaagctcctggagaa gaggagcgtcgatgacctcatcctttccgtcggatctggtggaggtggtg ctccagctgctgctgctgctgccccggctgctggtggtgctgctgccgct gaagagaagaaagaagagaaaaaggaggaggctaaggaagagagcgatga tgacatgggcttcagcttgttcgactaagcagttcaattccagttctcct gtggaatcttttatgctaaggattacttatcttatgtgcttttaggtcga attttgcggatttaatatgtttgagacctaagtatctgtgcaatgagtac tgcaaaccaccttgggatggtctttttagaatgaaaatggttttggtgct tggttgaaaagccattgcttgttttaccctaaaaaaaaaa
Download
page-top