Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ651746
Length 469 bp
Fasta Format > whem6d09
atgctatagcttctgacgcagcacgcccgaggacagaagatgttgagcac gcctttgataactaccactcgagccgcgtaatcagaaagatgatacttga ttgccctgagtttgccgctaccctatggaaaaaagccctcaaagggaagt gcaagtcatttgcagatggattcagctccaaggtggtggctgcctatctg gaatctccggattccaaggtgaaggatcttgcgaaatccgaggtgcagct gctcatcgacggtggcatactgaagaatccagaccataaagcagcggaga agaagtgagtcttctctcgacgggcctctcgccatcgccagcaacacaag caggccaaggcggcgtccgtgcttgcctgttgtggatgaaagagtgtaat acatacatccgtggtcatcctactcgaggtgtatgttcaattttggcact ggataccaatggactcgaa
Download
page-top