Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ650465
Length 461 bp
Fasta Format > whem20d02
aactgtggaccctgaatggtcctcttatgctgtatgtctccaagatgatt ccagcatctgacaagggtaggttctttgcctttggacgtgtttttgccgg gagggttgcaactggtatgaaggtccgtatcatgggtcccaactttgttc ctggccagaagaaggatctgtatgtgaagagtgtccagcgtactgttatc tggatgggaaagaagcaagagtctgttgaggatgttccctgtggtaacac tgttgctttggttggtttggatcagttcatcaccaagaatgcaaccctga caaatgagaaggaagttgatgcctgcccaatcanggcaatgaagttctct gtgtcccctgttgtgcgtgttgccgttcantgcaangnggcatctgatct tcctaancttgntnanggnttgaancnnctgncnaannctgaccctatnn ntcnctnnanc
Download
page-top