Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ650209
Length 486 bp
Fasta Format > whem19n22
taattcgagattttattgtccgccttccccgacgcgcagctgcctcgctg ccccggtgctgctgctcccctcccacccgccgcgccccgccgacgcctcc gccgatggaccgggaagaagtgacggagttcctgggccaggtgcccctcc tgcagtgcctccccggctcctccatccgcaggatcgccgaggccgtccag gtcaagcactacgaacctggtgattatgttgcccgtgaaggtgaacccgt agatggcctttgcatcatattggatgggcaggctgaagtttctgctcctg caaacacagaagaagcaaaccgtccagactatgtgttaaataagtatgac tactttggttacgggaccaatagttctgtacatcaagtaaatgttattgc cgtgacaaagctgtcctgctttgtattgccgagtcaatatggacatctgc tgcaaaccaaagacaatttggaatgcagaagaaaca
Download
page-top