Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ293311
Length 587 bp
Fasta Format > whsl31i23
ggggaggagaggtttgagattcagaaggcgtgatnattcatggcgagcgc caaggcgacgatggggcaggagaagcaagaccacttcgttctcaagagcg ggcatgccatgccggccgtcgggttgggcacctggagggctggctcggat actgctcactccgttcagacggccatcaccgaggctggatacaggcatgt ggacacagctgctgaatacggagtagaaaaggaggtcggcaaagggctta cagctgccatggaagctggaatcgacaggaaagatttgtttgtcacgtca aaattatggtgcacgaacttggtccctgagagggtgcggccagcattaga gagcacgctcaaggatctacagttggactacatcgacctttaccatattc attggccgttccggctgaaagatggggcacacaagcctccggaagcaggg gaggtgctggaattcgacatggagggggtgtggaaggagatggagaacct tgtcaaggacggactggttaaggacatcggcgtctgcaactacaccgtga ccaagctcgaccggctgctacggtctgcaaagattcc
Download
page-top