Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ649906
Length 659 bp
Fasta Format > whem18m05
gnttttttgagcaagcatcacaactcagcggcgcagaagtgctgaagtcg ccaaatgcatttattattagggtatcacaagggaagcaataacacttgaa gtcttaggctttcgcattagcactctggaagctacagcctttgccacaat agttgccaaagaaaattagcgcacaccctcaatggtgccagagctgaagt aaaccacagatctttcaatggtagaatgtcaagagtgagtgtggtcagag gaaaatgccatctctttcgctgatccagccgtgctgctcttcttactatg ttgaaaccgcaacggtgccctcaggaagagcagagatgtgcacaacaggt gtatgcgattttaatggtatgtcggagccggtaaccttcttctccgtcga cctgctcagcaccttcctcacctcatccgcaagcacaatgatcgagtcgt cttcatggcttatattggacagtgccttctccattgagaacaggtagtcc ctattatatccattagggccactggctgtagcaatttgccttgccatatc ctccaaagcagcagggccaagatagtatttgttgccaactggatcaggag tggatacgaaaactaatacatccgtcacagctggttccagagaatttcca tcccttgta
Download
page-top