Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ649901
Length 618 bp
Fasta Format > whem18l24
ttctgcatatacgagcaacttcgaattggttacaagcttatggcaaagag ggagctgaaggatccagagaatgcactaattggcgcctttgccggtgcga ttactggtgctataacaacccccctcgatgttctgaagacaaggttgatg gttcaggggcaaacaaagcaatactctggaattgtaagctgtgctaagac gatcttgagggaggaaggtcccggcgcctttttgaagggcatcgagccgc gagttctgtggatcggcatcggcgggtccatcttcttcggcgtgctggag aagaccaagtcggtcctcgctgagaggagcagccgcaaggctgcgctggc ggagaaggacgagtgaaccaaccaacccaccaagcaattgtgcatcctat gctgactcactccacatcattacccgttctttcacctgaagttttgctcc aattttatgtgatgggctttgcgtatctcgttccagaactattaaggcat acaatcagtttcaagagtttgttttgatgtcggcgatgatggttatgatc ctgtatgantccctgtaaacattactctcctttaataaagtttancanat tgttcttcaaaaaaaaaa
Download
page-top