Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ649886
Length 670 bp
Fasta Format > whem18l04
aatttctgatgatgaagatgaggaggagaagaaggatactgaggagggca aggttgaggatgttgatgaggagaaggaagagaaggaaaagaagaaaaag aagatcaaggaagtctctcacgagtggaacttggtcaacaagcagaagcc gatctggatgaggaagccagaggagatcaacaaggaagagtacgctgctt tctacaagagcttgaccaatgactgggaggagcatttggctgtcaagcac ttctctgttgagggtcagcttgagttcaaggctgtcctgtttgtgcccaa gagggcccccttcgacctcttcgacaacaagaagaaggccaacaacatca agctgtacgtgcgccgtgtcttcatcatggataactgtgaggagttgatc cctgagtacctgagctttgtcaagggcattgttgattcagaggaccttcc cctgaacatctcccgtgagactctccaacagaacaagatcctcaaggtca tcaggaagaaccttgtcaagaagtgcattgagctcttctttgagattgct ganaacaaggaggactacnacaagttctacgaggccttctccaagaacct caagcttggcatccacgaggactcccanaacaggaccaanattgctganc ttctgangtaccactccacc
Download
page-top