Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ649863
Length 660 bp
Fasta Format > whem18k01
gcgagctttttgaggttctcatcgagacttgcattgaaaatgttggagag ttacttagaacaaacttcggcaaagatgtattatacgaggttgctgtagg tggaaaaaataatgtcttggagggggtcaccgacagggtccacgtgcttc acaatgctatagcttctgacgcagcacgcccgaggacagaagatgttgag cacgcctttgataactaccactcgagccgcgtaatcagaaagatgatact tgattgccctgagtttgccgctaccctatggaaaaaagccctcaaaggga agtgcaagtcatttgcagatggattcagctccaaggtggtggctgcctat ctggaatctccggattccaaggtgaaggatcttgcgaaatccgaggtgca gctgctcatcgacggtggcatactgaagaatccagaccataaagcagcgg agaagaagtgagtcttctctcgacgggcctctcgccatcgccagcaacac aagcaggccaaggcggcgtccgtgcttgcctgttgtggatgaaagagtgt aatacatacatccgtggtcatcctactcnaggtgtatgttcaattttggc actggataccaatggactcnaaatacatacantcnttaanggtttangtt aanaaaaaaa
Download
page-top